ID: 1132834798_1132834802

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1132834798 1132834802
Species Human (GRCh38) Human (GRCh38)
Location 16:1947350-1947372 16:1947375-1947397
Sequence CCTTCTTCTGCCGGAAGGGCAGC TTTCATCTGCAGGACATGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 145} {0: 1, 1: 0, 2: 2, 3: 25, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!