ID: 1132840672_1132840683

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1132840672 1132840683
Species Human (GRCh38) Human (GRCh38)
Location 16:1977170-1977192 16:1977219-1977241
Sequence CCACCGGCGTGGCCTCTGGTGCG CTGGCCACGGCCTCAGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85} {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!