ID: 1132841143_1132841157

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1132841143 1132841157
Species Human (GRCh38) Human (GRCh38)
Location 16:1979044-1979066 16:1979096-1979118
Sequence CCTCGCGCTCACTGCTCCGTCGT GAGGGCGGCCCTGGCGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32} {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!