ID: 1132841148_1132841153

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1132841148 1132841153
Species Human (GRCh38) Human (GRCh38)
Location 16:1979060-1979082 16:1979087-1979109
Sequence CCGTCGTGGGGTGCGGCACAGAG CGCACCCTCGAGGGCGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 111} {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!