ID: 1132842313_1132842321

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132842313 1132842321
Species Human (GRCh38) Human (GRCh38)
Location 16:1984127-1984149 16:1984151-1984173
Sequence CCTCCGGCTCCTGTGGCCGCGCG TGGCCTGGAGGCTGACCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170} {0: 1, 1: 1, 2: 5, 3: 44, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!