ID: 1132845374_1132845389

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132845374 1132845389
Species Human (GRCh38) Human (GRCh38)
Location 16:1998800-1998822 16:1998845-1998867
Sequence CCCGGAAGTTCTCGGGGACTAGG GCCTGGGTCTGGGGGTCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 90} {0: 1, 1: 0, 2: 4, 3: 73, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!