ID: 1132849894_1132849909

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132849894 1132849909
Species Human (GRCh38) Human (GRCh38)
Location 16:2020246-2020268 16:2020291-2020313
Sequence CCGGAGCCCGCGCGCCCCAGAGC GGACTTCAGCGGAGCTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 257} {0: 1, 1: 0, 2: 0, 3: 24, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!