ID: 1132852462_1132852473

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1132852462 1132852473
Species Human (GRCh38) Human (GRCh38)
Location 16:2031008-2031030 16:2031038-2031060
Sequence CCACTGTGAGAACCGCGCTTGGG TGTGGGATCTGGAGTTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44} {0: 1, 1: 0, 2: 2, 3: 18, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!