ID: 1132852968_1132852985

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1132852968 1132852985
Species Human (GRCh38) Human (GRCh38)
Location 16:2033111-2033133 16:2033158-2033180
Sequence CCTTCCTTTCTTGGGACGGAAGC TGGAGCCTTCGCAGGGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110} {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!