ID: 1132860727_1132860733

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1132860727 1132860733
Species Human (GRCh38) Human (GRCh38)
Location 16:2070515-2070537 16:2070557-2070579
Sequence CCACATTCAGCTCCACTACAAGC CGCGAGCAGCATCCGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142} {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
19 16:2070515-2070537 CCACATTCAGCTCCACTACAAGC - 16:2070557-2070579 CGCGAGCAGCATCCGGCTGCAGG +