ID: 1132870041_1132870060

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1132870041 1132870060
Species Human (GRCh38) Human (GRCh38)
Location 16:2111920-2111942 16:2111972-2111994
Sequence CCCACCCGCTCGGCAGAAGCCCC CACCTGCGGCCCAGCCTTAAGGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 0, 3: 12, 4: 128} {0: 5, 1: 1, 2: 0, 3: 8, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!