ID: 1132870920_1132870929

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1132870920 1132870929
Species Human (GRCh38) Human (GRCh38)
Location 16:2115453-2115475 16:2115470-2115492
Sequence CCCTGGCCCTGACGTGCAGCCAT AGCCATTGGCGCAGGCCTGGGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 7, 4: 130} {0: 4, 1: 0, 2: 1, 3: 10, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!