ID: 1132871166_1132871177

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1132871166 1132871177
Species Human (GRCh38) Human (GRCh38)
Location 16:2116397-2116419 16:2116446-2116468
Sequence CCAACCATCTTCACTGGGCACAA GGCGAGACCCACAGTGGGCAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 1, 3: 12, 4: 175} {0: 4, 1: 2, 2: 1, 3: 27, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!