ID: 1132872628_1132872638

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1132872628 1132872638
Species Human (GRCh38) Human (GRCh38)
Location 16:2122542-2122564 16:2122557-2122579
Sequence CCATCCCCGCCGTGGGGTGGGAC GGTGGGACAGGGTGGTGGCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 135} {0: 1, 1: 1, 2: 9, 3: 79, 4: 713}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!