ID: 1132876882_1132876898

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132876882 1132876898
Species Human (GRCh38) Human (GRCh38)
Location 16:2143942-2143964 16:2143993-2144015
Sequence CCAGGGGCACATAGCAAGCCGGG CTCCAGAGGAGGGTCTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 214} {0: 2, 1: 0, 2: 1, 3: 28, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!