ID: 1132879532_1132879538

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1132879532 1132879538
Species Human (GRCh38) Human (GRCh38)
Location 16:2155880-2155902 16:2155893-2155915
Sequence CCGACCCGGGGCTCGCGCCTCGG CGCGCCTCGGGACCGCGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100} {0: 1, 1: 0, 2: 1, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!