ID: 1132884899_1132884916

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1132884899 1132884916
Species Human (GRCh38) Human (GRCh38)
Location 16:2178367-2178389 16:2178399-2178421
Sequence CCCTTGGAGCCCCCGGCCAGGCG GGGCGCCCCGGCCCGGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122} {0: 1, 1: 0, 2: 2, 3: 44, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!