ID: 1132885995_1132886002

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1132885995 1132886002
Species Human (GRCh38) Human (GRCh38)
Location 16:2182233-2182255 16:2182263-2182285
Sequence CCATGGGGAGACACACCCGAGTC CAGACGCATGGGGCCACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 2, 3: 120, 4: 1617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!