ID: 1132886194_1132886204

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132886194 1132886204
Species Human (GRCh38) Human (GRCh38)
Location 16:2183294-2183316 16:2183322-2183344
Sequence CCCCCTACAGTCTGCATGTGAGT TGCTTGGAGGCTTGGTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 137} {0: 1, 1: 0, 2: 3, 3: 30, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!