ID: 1132888119_1132888125

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1132888119 1132888125
Species Human (GRCh38) Human (GRCh38)
Location 16:2191319-2191341 16:2191335-2191357
Sequence CCTGCTGCCCCGGCCTCAGTCCC CAGTCCCAGCCACTGGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 638} {0: 1, 1: 0, 2: 5, 3: 27, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!