ID: 1132889017_1132889032

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1132889017 1132889032
Species Human (GRCh38) Human (GRCh38)
Location 16:2195319-2195341 16:2195359-2195381
Sequence CCCCCTGGAGGAAGGGGAGGGGG CTGTGGGGGTGGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 90, 4: 777} {0: 1, 1: 1, 2: 28, 3: 265, 4: 2218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!