ID: 1132893167_1132893179

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132893167 1132893179
Species Human (GRCh38) Human (GRCh38)
Location 16:2214479-2214501 16:2214507-2214529
Sequence CCGAAGACCTCCAGGCTGGCGCC CCGCGGGGCCGCCGAAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 172} {0: 1, 1: 0, 2: 5, 3: 29, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!