ID: 1132913628_1132913641

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1132913628 1132913641
Species Human (GRCh38) Human (GRCh38)
Location 16:2329569-2329591 16:2329618-2329640
Sequence CCAGGGCTGGGAGAGAAGGTCAG CAGGCTGCAGGGCAGTACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 464} {0: 1, 1: 0, 2: 11, 3: 194, 4: 2397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!