ID: 1132920316_1132920324

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132920316 1132920324
Species Human (GRCh38) Human (GRCh38)
Location 16:2386196-2386218 16:2386240-2386262
Sequence CCTGAGCGGGGGCATGAGCCGCA TCATCGCAGGCTCCAAGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 7, 4: 117} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!