ID: 1132920316_1132920327

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132920316 1132920327
Species Human (GRCh38) Human (GRCh38)
Location 16:2386196-2386218 16:2386247-2386269
Sequence CCTGAGCGGGGGCATGAGCCGCA AGGCTCCAAGGTGCGGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 7, 4: 117} {0: 1, 1: 1, 2: 0, 3: 6, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!