ID: 1132934579_1132934586

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1132934579 1132934586
Species Human (GRCh38) Human (GRCh38)
Location 16:2474210-2474232 16:2474226-2474248
Sequence CCTGGGCCGCCGCCCCGTCCCCG GTCCCCGCCGGCAGCTCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 185, 4: 6788} {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!