ID: 1132942306_1132942316

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1132942306 1132942316
Species Human (GRCh38) Human (GRCh38)
Location 16:2514300-2514322 16:2514321-2514343
Sequence CCCGGGCCTCGTGTGACAGCGGG GGCGGGGGTCGGCGCCCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83} {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!