ID: 1132968437_1132968448

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132968437 1132968448
Species Human (GRCh38) Human (GRCh38)
Location 16:2673082-2673104 16:2673106-2673128
Sequence CCCGGCCTCCCCCGCCCTCCGCG GTCTGTCAGCGCCCCCGGCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 10, 3: 123, 4: 870} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!