ID: 1132973931_1132973939

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132973931 1132973939
Species Human (GRCh38) Human (GRCh38)
Location 16:2702217-2702239 16:2702260-2702282
Sequence CCATCCATTTCCTGAAGCGTCGG GCGGTGGCAGGCGCGTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48} {0: 1, 1: 0, 2: 0, 3: 4, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!