ID: 1132977759_1132977779

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1132977759 1132977779
Species Human (GRCh38) Human (GRCh38)
Location 16:2719206-2719228 16:2719259-2719281
Sequence CCTTCCACCTCCTGTGCACATGG GAGACTGGGGGCATGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 390} {0: 1, 1: 0, 2: 6, 3: 99, 4: 772}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!