ID: 1132987722_1132987728

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1132987722 1132987728
Species Human (GRCh38) Human (GRCh38)
Location 16:2776807-2776829 16:2776838-2776860
Sequence CCCGGACCGGAGATCCCCGCGGC CTCGCGCTTCACCCGCACAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72} {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!