ID: 1132987740_1132987745

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1132987740 1132987745
Species Human (GRCh38) Human (GRCh38)
Location 16:2776886-2776908 16:2776911-2776933
Sequence CCCGCAGGCGTCGCCGGCCGCTA GTTTACATCGCGGACAGCGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44} {0: 1, 1: 0, 2: 0, 3: 0, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!