ID: 1132989256_1132989266

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1132989256 1132989266
Species Human (GRCh38) Human (GRCh38)
Location 16:2784747-2784769 16:2784787-2784809
Sequence CCCACCAGGACCCAGCTCCCAGA GTCCCCCAGAATCACCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 154, 4: 2553} {0: 1, 1: 2, 2: 3, 3: 23, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!