ID: 1132998996_1132999009

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1132998996 1132999009
Species Human (GRCh38) Human (GRCh38)
Location 16:2839863-2839885 16:2839916-2839938
Sequence CCAGCTCACAATGCCGGCCTGGA GCCCCCCGGAGTCACCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 82} {0: 1, 1: 0, 2: 2, 3: 14, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!