ID: 1132999269_1132999272

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1132999269 1132999272
Species Human (GRCh38) Human (GRCh38)
Location 16:2840963-2840985 16:2840986-2841008
Sequence CCATGGTATGAGGAGTGGACCAG GAGCCTCCTCACAGCCACCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 117} {0: 1, 1: 0, 2: 2, 3: 30, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!