ID: 1133012380_1133012384

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1133012380 1133012384
Species Human (GRCh38) Human (GRCh38)
Location 16:2921333-2921355 16:2921363-2921385
Sequence CCACCATCAATTTTAGGACTTTT TTGCTTCTAAAGCCAGAGGGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 33, 3: 305, 4: 883} {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!