ID: 1133013342_1133013346

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133013342 1133013346
Species Human (GRCh38) Human (GRCh38)
Location 16:2927017-2927039 16:2927046-2927068
Sequence CCAACCGCCATTAGCTTATCAAT TGCCAGCCGAGCTTCAGTATTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 19, 3: 10, 4: 61} {0: 1, 1: 1, 2: 8, 3: 12, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!