ID: 1133013822_1133013831

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1133013822 1133013831
Species Human (GRCh38) Human (GRCh38)
Location 16:2929780-2929802 16:2929824-2929846
Sequence CCCCCAGGAAGCCCAGGGAGTTC GCCTCCGACCAAGATGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 296} {0: 1, 1: 0, 2: 2, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!