ID: 1133015635_1133015647

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1133015635 1133015647
Species Human (GRCh38) Human (GRCh38)
Location 16:2938206-2938228 16:2938255-2938277
Sequence CCTGAGGACTTCCCTGGGGGGCA TACAGGAAGGAGAAGGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 237} {0: 2, 1: 0, 2: 1, 3: 42, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!