ID: 1133021258_1133021273

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1133021258 1133021273
Species Human (GRCh38) Human (GRCh38)
Location 16:2967911-2967933 16:2967937-2967959
Sequence CCTTGCCCTGCTCCCCCGGGGAC CAGGCTGAGGGTTCTGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 431} {0: 1, 1: 0, 2: 2, 3: 11, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!