ID: 1133021582_1133021588

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133021582 1133021588
Species Human (GRCh38) Human (GRCh38)
Location 16:2969274-2969296 16:2969303-2969325
Sequence CCGGCGGGAACTAGGAGCCTGGG CTGGCGTCCCCTCCCGCGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 127} {0: 1, 1: 0, 2: 2, 3: 16, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!