ID: 1133022831_1133022840

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133022831 1133022840
Species Human (GRCh38) Human (GRCh38)
Location 16:2974376-2974398 16:2974422-2974444
Sequence CCAGCATCATGACAAGGACAGAA CCATGAGGAAGGGCCACATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220} {0: 1, 1: 1, 2: 0, 3: 24, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!