ID: 1133022831_1133022841

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1133022831 1133022841
Species Human (GRCh38) Human (GRCh38)
Location 16:2974376-2974398 16:2974423-2974445
Sequence CCAGCATCATGACAAGGACAGAA CATGAGGAAGGGCCACATCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220} {0: 1, 1: 1, 2: 1, 3: 15, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!