ID: 1133023389_1133023394

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133023389 1133023394
Species Human (GRCh38) Human (GRCh38)
Location 16:2976754-2976776 16:2976783-2976805
Sequence CCCAGGGCTCTGCAGAGTCTCTG CGCCCCGGAATGACACCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 349} {0: 1, 1: 0, 2: 0, 3: 3, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!