ID: 1133054849_1133054862

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1133054849 1133054862
Species Human (GRCh38) Human (GRCh38)
Location 16:3140779-3140801 16:3140817-3140839
Sequence CCTGGAGCCCCGAGGAGGCTGAG AACCGGCCGAGGGCGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 452} {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!