ID: 1133056312_1133056316

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1133056312 1133056316
Species Human (GRCh38) Human (GRCh38)
Location 16:3147235-3147257 16:3147248-3147270
Sequence CCTCAACATTGTTCCCACCCCAG CCCACCCCAGGCTTTCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 317} {0: 1, 1: 0, 2: 7, 3: 50, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!