ID: 1133097673_1133097685

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1133097673 1133097685
Species Human (GRCh38) Human (GRCh38)
Location 16:3458276-3458298 16:3458321-3458343
Sequence CCAGCGCCCACCGGGTACGAGCG GCGCCCGCGCCCCCGGCGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 400} {0: 1, 1: 0, 2: 2, 3: 23, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!