ID: 1133098115_1133098120

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1133098115 1133098120
Species Human (GRCh38) Human (GRCh38)
Location 16:3461348-3461370 16:3461367-3461389
Sequence CCCCCTGCGGAGGTGGGCAGAGA GAGAGGTGCCAGTCACCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 202} {0: 1, 1: 0, 2: 1, 3: 20, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!