ID: 1133098124_1133098127

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1133098124 1133098127
Species Human (GRCh38) Human (GRCh38)
Location 16:3461384-3461406 16:3461402-3461424
Sequence CCAAGGTGCCACAGCTCTAAGCT AAGCTGAGATGGTCAGATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 172} {0: 1, 1: 0, 2: 0, 3: 10, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!