ID: 1133099373_1133099380

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1133099373 1133099380
Species Human (GRCh38) Human (GRCh38)
Location 16:3469993-3470015 16:3470033-3470055
Sequence CCTGCTGGGGCTGCCCTGGGGCC AGGTCCTTTGTCTCGTGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 93, 4: 723} {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!